ely to FH in the alternative complement pathway. The increased level of the capsules may enhance phagocytosis resistance, but could also reduce adhesion to the mucosal surface. has less hyaluronic acid than S. equi. Therefore, S. zooepidemicus has stronger adhesiveness but lower level of capsules, which rendered it more susceptible to phagocytosis. Having an effective antiphagocytosis mechanism is therefore essential to S. zooepidemicus. Recruiting FH via SzP and TRX to its cell surface would certainly contribute to phagocytosis evasion. When FH was not abundant, S. zooepidemicus could use TRX as succedaneum of FH. C3 deposition experiments showed that TRX and FH both prevented deposition of C3b on S. zooepidemicus, which was pretreated with both TRX and FH limited deposition of opsonic C3b on the bacterial surface. This indicated that the SzP/TRX interaction contributed to the antiphagocytosis response in S. zooepidemicus via the inhibition of the C3b deposition. In conclusion, the SzP/TRX interaction was a novel antiphagocytic mechanism of S. zooepidemicus. The SzP/TRX interaction did not influence the TRX activity and function. It also contributed to the FH recruitment and reduced the 
C3 deposition on the bacterial surface, allowing S. zooepidemicus to be more evasive to the alternative complement pathways. These mechanisms were very beneficial for S. zooepidemicus to evade phagocytosis of the host immune system. Additional studies of this interaction will undoubtedly help us to understand better how SzP is involved in the antiphagocytosis mechanisms. Escherichia coli strains DH5a, DH10B and BL21, Saccharomyces cerevisiae strain NMY51 4-HIS3 ura3::8-lacZ ade2::8ADE2 GAL4) were used in this study. S. zooepidemicus was cultured with fresh Todd-Hewitt broth medium. E.coli was cultured with fresh LuriaBertani medium. S. cerevisiae was cultured with fresh Yeast Extract Peptone Dextrose Adenine hemisulfate medium. Raw264.7 cells and HEK 293 cells were transiently AUY-922 transfected using Lipofectamine 2000 and opti-MEM according to the manufacturer’s instruction. Media were changed 6 h post transfection and the cells were treated or assayed 24 h post transfection. S. cerevisiae was transformed using the LiAc method. Lysates were subject to Western-blot analysis to confirm the expression of the bait gene in the pDHB1 plasmid. PubMed ID:http://www.ncbi.nlm.nih.gov/pubmed/22189475 Split-ubiquitin yeast two-hybrid assay We used the Split-ubiquitin yeast two-hybrid DUALhunter system to identify SzP interaction partners from the porcine macrophages. The coding region of S. zooepidemicus ATCC35246 SzP, excluding the signal sequence, was amplified by PCR using primers 59- GCGGCACGGCCATTACGGCCGTTGAGTCAGCTAAGCCTGTA -39 and 59- GCAGCGCGGCCGAGGCGGCCTTTTCTTTGCGTCTTGTTGAC -39. PCR product was then inserted into the Split-ubiquitin yeast two-hybrid Cub domain vector pDHB1 to generate the `bait’ plasmid pDHB1-SzP, which was verified by DNA sequencing. The expression of the bait protein was confirmed. pDHB1-SzP was used to screen a porcine PAM cDNA library for identifying SzP interacting proteins. Positive yeast clones containing the library plasmid encoding Szp interacting proteins were purified and retested for their growth phenotypes. Plasmid DNA preparations for these yeast clones were generated by the Yeast Plasmid Extraction Kit. The insert fragment of these prey plasmids was detected by PCR amplification using primers pPR3NF and pPR3N -R. The chosen prey plasmids were amplified in DH5a, recovered through ampi
